ID: 1050888736

View in Genome Browser
Species Human (GRCh38)
Location 9:10796760-10796782
Sequence GTCTTTTGAGAGACAGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050888736_1050888737 -3 Left 1050888736 9:10796760-10796782 CCATGATCTGTCTCTCAAAAGAC No data
Right 1050888737 9:10796780-10796802 GACTAGTTATCTGCAGAAGATGG No data
1050888736_1050888738 1 Left 1050888736 9:10796760-10796782 CCATGATCTGTCTCTCAAAAGAC No data
Right 1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG No data
1050888736_1050888739 24 Left 1050888736 9:10796760-10796782 CCATGATCTGTCTCTCAAAAGAC No data
Right 1050888739 9:10796807-10796829 ACCTTGCTCCAAAACCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050888736 Original CRISPR GTCTTTTGAGAGACAGATCA TGG (reversed) Intergenic
No off target data available for this crispr