ID: 1050888738

View in Genome Browser
Species Human (GRCh38)
Location 9:10796784-10796806
Sequence AGTTATCTGCAGAAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050888736_1050888738 1 Left 1050888736 9:10796760-10796782 CCATGATCTGTCTCTCAAAAGAC No data
Right 1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050888738 Original CRISPR AGTTATCTGCAGAAGATGGT AGG Intergenic
No off target data available for this crispr