ID: 1050889479

View in Genome Browser
Species Human (GRCh38)
Location 9:10806188-10806210
Sequence CTGAGTGAAAAGAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050889479_1050889486 28 Left 1050889479 9:10806188-10806210 CCCTCCTGCCTCTTTTCACTCAG No data
Right 1050889486 9:10806239-10806261 CTAATAATTCCTACTATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050889479 Original CRISPR CTGAGTGAAAAGAGGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr