ID: 1050889486

View in Genome Browser
Species Human (GRCh38)
Location 9:10806239-10806261
Sequence CTAATAATTCCTACTATCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050889480_1050889486 27 Left 1050889480 9:10806189-10806211 CCTCCTGCCTCTTTTCACTCAGT No data
Right 1050889486 9:10806239-10806261 CTAATAATTCCTACTATCATAGG No data
1050889484_1050889486 -1 Left 1050889484 9:10806217-10806239 CCTTCCAAAGCTAACTGTTGTAC No data
Right 1050889486 9:10806239-10806261 CTAATAATTCCTACTATCATAGG No data
1050889483_1050889486 3 Left 1050889483 9:10806213-10806235 CCTGCCTTCCAAAGCTAACTGTT No data
Right 1050889486 9:10806239-10806261 CTAATAATTCCTACTATCATAGG No data
1050889481_1050889486 24 Left 1050889481 9:10806192-10806214 CCTGCCTCTTTTCACTCAGTTCC No data
Right 1050889486 9:10806239-10806261 CTAATAATTCCTACTATCATAGG No data
1050889485_1050889486 -5 Left 1050889485 9:10806221-10806243 CCAAAGCTAACTGTTGTACTAAT No data
Right 1050889486 9:10806239-10806261 CTAATAATTCCTACTATCATAGG No data
1050889482_1050889486 20 Left 1050889482 9:10806196-10806218 CCTCTTTTCACTCAGTTCCTGCC No data
Right 1050889486 9:10806239-10806261 CTAATAATTCCTACTATCATAGG No data
1050889479_1050889486 28 Left 1050889479 9:10806188-10806210 CCCTCCTGCCTCTTTTCACTCAG No data
Right 1050889486 9:10806239-10806261 CTAATAATTCCTACTATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050889486 Original CRISPR CTAATAATTCCTACTATCAT AGG Intergenic
No off target data available for this crispr