ID: 1050890625

View in Genome Browser
Species Human (GRCh38)
Location 9:10819845-10819867
Sequence AAAAATGCTGAGAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050890625_1050890627 4 Left 1050890625 9:10819845-10819867 CCCATATCACTCTCAGCATTTTT No data
Right 1050890627 9:10819872-10819894 ACACCATTCAACAAGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050890625 Original CRISPR AAAAATGCTGAGAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr