ID: 1050890627

View in Genome Browser
Species Human (GRCh38)
Location 9:10819872-10819894
Sequence ACACCATTCAACAAGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050890624_1050890627 18 Left 1050890624 9:10819831-10819853 CCTGTACTTCATTGCCCATATCA No data
Right 1050890627 9:10819872-10819894 ACACCATTCAACAAGTCTTCAGG No data
1050890625_1050890627 4 Left 1050890625 9:10819845-10819867 CCCATATCACTCTCAGCATTTTT No data
Right 1050890627 9:10819872-10819894 ACACCATTCAACAAGTCTTCAGG No data
1050890626_1050890627 3 Left 1050890626 9:10819846-10819868 CCATATCACTCTCAGCATTTTTA No data
Right 1050890627 9:10819872-10819894 ACACCATTCAACAAGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050890627 Original CRISPR ACACCATTCAACAAGTCTTC AGG Intergenic
No off target data available for this crispr