ID: 1050891897

View in Genome Browser
Species Human (GRCh38)
Location 9:10835209-10835231
Sequence CAGGGTCTGAAACATGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050891897_1050891903 27 Left 1050891897 9:10835209-10835231 CCTGAACCATGTTTCAGACCCTG No data
Right 1050891903 9:10835259-10835281 ATTTCCCATACTCCTACTTCAGG No data
1050891897_1050891904 28 Left 1050891897 9:10835209-10835231 CCTGAACCATGTTTCAGACCCTG No data
Right 1050891904 9:10835260-10835282 TTTCCCATACTCCTACTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050891897 Original CRISPR CAGGGTCTGAAACATGGTTC AGG (reversed) Intergenic
No off target data available for this crispr