ID: 1050894900

View in Genome Browser
Species Human (GRCh38)
Location 9:10873827-10873849
Sequence TCATTCCCACATATTGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050894900_1050894902 -2 Left 1050894900 9:10873827-10873849 CCTCTCTCAATATGTGGGAATGA No data
Right 1050894902 9:10873848-10873870 GACAATTTGAGAAGACATTTGGG No data
1050894900_1050894904 3 Left 1050894900 9:10873827-10873849 CCTCTCTCAATATGTGGGAATGA No data
Right 1050894904 9:10873853-10873875 TTTGAGAAGACATTTGGGTTGGG No data
1050894900_1050894901 -3 Left 1050894900 9:10873827-10873849 CCTCTCTCAATATGTGGGAATGA No data
Right 1050894901 9:10873847-10873869 TGACAATTTGAGAAGACATTTGG No data
1050894900_1050894903 2 Left 1050894900 9:10873827-10873849 CCTCTCTCAATATGTGGGAATGA No data
Right 1050894903 9:10873852-10873874 ATTTGAGAAGACATTTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050894900 Original CRISPR TCATTCCCACATATTGAGAG AGG (reversed) Intergenic
No off target data available for this crispr