ID: 1050895893

View in Genome Browser
Species Human (GRCh38)
Location 9:10885835-10885857
Sequence GCAAGTACTGCTTTTCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050895885_1050895893 -1 Left 1050895885 9:10885813-10885835 CCTTGGTCCTTCACCCTTAGCGG 0: 269
1: 300
2: 309
3: 399
4: 245
Right 1050895893 9:10885835-10885857 GCAAGTACTGCTTTTCTTGGGGG No data
1050895883_1050895893 16 Left 1050895883 9:10885796-10885818 CCACATGGGGATGGCTGCCTTGG No data
Right 1050895893 9:10885835-10885857 GCAAGTACTGCTTTTCTTGGGGG No data
1050895887_1050895893 -8 Left 1050895887 9:10885820-10885842 CCTTCACCCTTAGCGGCAAGTAC 0: 30
1: 541
2: 622
3: 211
4: 94
Right 1050895893 9:10885835-10885857 GCAAGTACTGCTTTTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050895893 Original CRISPR GCAAGTACTGCTTTTCTTGG GGG Intergenic
No off target data available for this crispr