ID: 1050897368

View in Genome Browser
Species Human (GRCh38)
Location 9:10900201-10900223
Sequence CAAAATGATGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050897368_1050897371 5 Left 1050897368 9:10900201-10900223 CCCATATCACTATCATCATTTTG No data
Right 1050897371 9:10900229-10900251 AGACCATTCAACAAGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050897368 Original CRISPR CAAAATGATGATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr