ID: 1050902682

View in Genome Browser
Species Human (GRCh38)
Location 9:10966434-10966456
Sequence GTGCACACCCCCTATGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050902682_1050902690 12 Left 1050902682 9:10966434-10966456 CCAATATCATAGGGGGTGTGCAC No data
Right 1050902690 9:10966469-10966491 TTGTTCCTTATATCCTGGGAGGG No data
1050902682_1050902688 8 Left 1050902682 9:10966434-10966456 CCAATATCATAGGGGGTGTGCAC No data
Right 1050902688 9:10966465-10966487 GACATTGTTCCTTATATCCTGGG No data
1050902682_1050902692 17 Left 1050902682 9:10966434-10966456 CCAATATCATAGGGGGTGTGCAC No data
Right 1050902692 9:10966474-10966496 CCTTATATCCTGGGAGGGAGAGG No data
1050902682_1050902689 11 Left 1050902682 9:10966434-10966456 CCAATATCATAGGGGGTGTGCAC No data
Right 1050902689 9:10966468-10966490 ATTGTTCCTTATATCCTGGGAGG No data
1050902682_1050902687 7 Left 1050902682 9:10966434-10966456 CCAATATCATAGGGGGTGTGCAC No data
Right 1050902687 9:10966464-10966486 TGACATTGTTCCTTATATCCTGG No data
1050902682_1050902694 30 Left 1050902682 9:10966434-10966456 CCAATATCATAGGGGGTGTGCAC No data
Right 1050902694 9:10966487-10966509 GAGGGAGAGGATGATACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050902682 Original CRISPR GTGCACACCCCCTATGATAT TGG (reversed) Intergenic
No off target data available for this crispr