ID: 1050903420

View in Genome Browser
Species Human (GRCh38)
Location 9:10974528-10974550
Sequence CAGCGCTGAGAACTTGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050903420_1050903430 27 Left 1050903420 9:10974528-10974550 CCTCCGGCAAGTTCTCAGCGCTG No data
Right 1050903430 9:10974578-10974600 GAGCTGTTGTGGCTGCATGGTGG No data
1050903420_1050903428 16 Left 1050903420 9:10974528-10974550 CCTCCGGCAAGTTCTCAGCGCTG No data
Right 1050903428 9:10974567-10974589 GAATAGACTTGGAGCTGTTGTGG No data
1050903420_1050903426 5 Left 1050903420 9:10974528-10974550 CCTCCGGCAAGTTCTCAGCGCTG No data
Right 1050903426 9:10974556-10974578 CAGCTGCCTGGGAATAGACTTGG No data
1050903420_1050903424 -6 Left 1050903420 9:10974528-10974550 CCTCCGGCAAGTTCTCAGCGCTG No data
Right 1050903424 9:10974545-10974567 GCGCTGGTCACCAGCTGCCTGGG No data
1050903420_1050903423 -7 Left 1050903420 9:10974528-10974550 CCTCCGGCAAGTTCTCAGCGCTG No data
Right 1050903423 9:10974544-10974566 AGCGCTGGTCACCAGCTGCCTGG No data
1050903420_1050903429 24 Left 1050903420 9:10974528-10974550 CCTCCGGCAAGTTCTCAGCGCTG No data
Right 1050903429 9:10974575-10974597 TTGGAGCTGTTGTGGCTGCATGG No data
1050903420_1050903431 28 Left 1050903420 9:10974528-10974550 CCTCCGGCAAGTTCTCAGCGCTG No data
Right 1050903431 9:10974579-10974601 AGCTGTTGTGGCTGCATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050903420 Original CRISPR CAGCGCTGAGAACTTGCCGG AGG (reversed) Intergenic
No off target data available for this crispr