ID: 1050905839

View in Genome Browser
Species Human (GRCh38)
Location 9:11004315-11004337
Sequence CTTATCCATGCCCTCATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050905839_1050905843 16 Left 1050905839 9:11004315-11004337 CCCTTGATGAGGGCATGGATAAG No data
Right 1050905843 9:11004354-11004376 TCTCCAGGTCATTACATGTCTGG No data
1050905839_1050905842 1 Left 1050905839 9:11004315-11004337 CCCTTGATGAGGGCATGGATAAG No data
Right 1050905842 9:11004339-11004361 TAACAAAGCAAATTTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050905839 Original CRISPR CTTATCCATGCCCTCATCAA GGG (reversed) Intergenic
No off target data available for this crispr