ID: 1050909079

View in Genome Browser
Species Human (GRCh38)
Location 9:11043635-11043657
Sequence ACATATCTGAAGAGGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050909079_1050909084 0 Left 1050909079 9:11043635-11043657 CCGTCCACCCTCTTCAGATATGT No data
Right 1050909084 9:11043658-11043680 TTCTTAGTTTGGTAAGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050909079 Original CRISPR ACATATCTGAAGAGGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr