ID: 1050910169

View in Genome Browser
Species Human (GRCh38)
Location 9:11057693-11057715
Sequence ATCTGTAAGGTATAGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050910169_1050910174 -7 Left 1050910169 9:11057693-11057715 CCCCCATTCTATACCTTACAGAT No data
Right 1050910174 9:11057709-11057731 TACAGATTCCGACCCAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050910169 Original CRISPR ATCTGTAAGGTATAGAATGG GGG (reversed) Intergenic
No off target data available for this crispr