ID: 1050911745

View in Genome Browser
Species Human (GRCh38)
Location 9:11080307-11080329
Sequence ATAAACCCATTGGCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050911745_1050911748 27 Left 1050911745 9:11080307-11080329 CCTGTTTTTGCCAATGGGTTTAT No data
Right 1050911748 9:11080357-11080379 AAAAATAGAACAATTACTGCTGG No data
1050911745_1050911747 -4 Left 1050911745 9:11080307-11080329 CCTGTTTTTGCCAATGGGTTTAT No data
Right 1050911747 9:11080326-11080348 TTATGAGAATGAAGAAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050911745 Original CRISPR ATAAACCCATTGGCAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr