ID: 1050913969

View in Genome Browser
Species Human (GRCh38)
Location 9:11108166-11108188
Sequence GCTTCCCTCTGACCTGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050913969_1050913976 8 Left 1050913969 9:11108166-11108188 CCTATCCCAGGTCAGAGGGAAGC No data
Right 1050913976 9:11108197-11108219 TTAAAGGGTGATTCCCAGACAGG No data
1050913969_1050913973 -7 Left 1050913969 9:11108166-11108188 CCTATCCCAGGTCAGAGGGAAGC No data
Right 1050913973 9:11108182-11108204 GGGAAGCCAACTGCCTTAAAGGG No data
1050913969_1050913972 -8 Left 1050913969 9:11108166-11108188 CCTATCCCAGGTCAGAGGGAAGC No data
Right 1050913972 9:11108181-11108203 AGGGAAGCCAACTGCCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050913969 Original CRISPR GCTTCCCTCTGACCTGGGAT AGG (reversed) Intergenic
No off target data available for this crispr