ID: 1050915440

View in Genome Browser
Species Human (GRCh38)
Location 9:11124765-11124787
Sequence TTATAGTTCTCTAGGTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050915438_1050915440 -7 Left 1050915438 9:11124749-11124771 CCATAAATTTATTATCTTATAGT No data
Right 1050915440 9:11124765-11124787 TTATAGTTCTCTAGGTCAGAAGG No data
1050915437_1050915440 14 Left 1050915437 9:11124728-11124750 CCACTTCAGTGACATGAAACACC No data
Right 1050915440 9:11124765-11124787 TTATAGTTCTCTAGGTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050915440 Original CRISPR TTATAGTTCTCTAGGTCAGA AGG Intergenic
No off target data available for this crispr