ID: 1050923584

View in Genome Browser
Species Human (GRCh38)
Location 9:11235455-11235477
Sequence CTGCTCTGTCAGATGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050923580_1050923584 -6 Left 1050923580 9:11235438-11235460 CCAAGATGGCAATGCTACTGCTC No data
Right 1050923584 9:11235455-11235477 CTGCTCTGTCAGATGGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050923584 Original CRISPR CTGCTCTGTCAGATGGGGCT AGG Intergenic
No off target data available for this crispr