ID: 1050945556

View in Genome Browser
Species Human (GRCh38)
Location 9:11511976-11511998
Sequence CTCTGTTAGGGCAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050945551_1050945556 -10 Left 1050945551 9:11511963-11511985 CCTCATGGAGAACCTCTGTTAGG 0: 47
1: 1160
2: 1643
3: 1360
4: 980
Right 1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG No data
1050945547_1050945556 7 Left 1050945547 9:11511946-11511968 CCTAGTCCATGTGGAGCCCTCAT No data
Right 1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG No data
1050945543_1050945556 25 Left 1050945543 9:11511928-11511950 CCATGATTGTGAGGCCTCCCTAG 0: 309
1: 4717
2: 6860
3: 4735
4: 2405
Right 1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG No data
1050945546_1050945556 8 Left 1050945546 9:11511945-11511967 CCCTAGTCCATGTGGAGCCCTCA No data
Right 1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG No data
1050945545_1050945556 11 Left 1050945545 9:11511942-11511964 CCTCCCTAGTCCATGTGGAGCCC No data
Right 1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG No data
1050945549_1050945556 1 Left 1050945549 9:11511952-11511974 CCATGTGGAGCCCTCATGGAGAA No data
Right 1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG No data
1050945550_1050945556 -9 Left 1050945550 9:11511962-11511984 CCCTCATGGAGAACCTCTGTTAG 0: 46
1: 1151
2: 1534
3: 1216
4: 943
Right 1050945556 9:11511976-11511998 CTCTGTTAGGGCAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050945556 Original CRISPR CTCTGTTAGGGCAATGTGGA AGG Intergenic
No off target data available for this crispr