ID: 1050951162

View in Genome Browser
Species Human (GRCh38)
Location 9:11596209-11596231
Sequence ACTCATGTAGAGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050951153_1050951162 29 Left 1050951153 9:11596157-11596179 CCCTGGCTTTGAAGAGTAGCAGT No data
Right 1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG No data
1050951154_1050951162 28 Left 1050951154 9:11596158-11596180 CCTGGCTTTGAAGAGTAGCAGTG No data
Right 1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG No data
1050951155_1050951162 -8 Left 1050951155 9:11596194-11596216 CCCCACATGTTCTCCACTCATGT No data
Right 1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG No data
1050951157_1050951162 -10 Left 1050951157 9:11596196-11596218 CCACATGTTCTCCACTCATGTAG No data
Right 1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG No data
1050951156_1050951162 -9 Left 1050951156 9:11596195-11596217 CCCACATGTTCTCCACTCATGTA No data
Right 1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050951162 Original CRISPR ACTCATGTAGAGATGGAGGA GGG Intergenic
No off target data available for this crispr