ID: 1050962250

View in Genome Browser
Species Human (GRCh38)
Location 9:11749559-11749581
Sequence CCGACTTTGAAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050962250_1050962254 12 Left 1050962250 9:11749559-11749581 CCTTCCTCCATCTTCAAAGTCGG No data
Right 1050962254 9:11749594-11749616 ATCTGTCTTGTCTGACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050962250 Original CRISPR CCGACTTTGAAGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr