ID: 1050964579

View in Genome Browser
Species Human (GRCh38)
Location 9:11782639-11782661
Sequence TTTATAAATTATCCCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26012
Summary {0: 7, 1: 102, 2: 1244, 3: 9212, 4: 15447}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050964579_1050964581 16 Left 1050964579 9:11782639-11782661 CCTGAGATGGGATAATTTATAAA 0: 7
1: 102
2: 1244
3: 9212
4: 15447
Right 1050964581 9:11782678-11782700 GACTCACTGTACCACATGACTGG No data
1050964579_1050964584 28 Left 1050964579 9:11782639-11782661 CCTGAGATGGGATAATTTATAAA 0: 7
1: 102
2: 1244
3: 9212
4: 15447
Right 1050964584 9:11782690-11782712 CACATGACTGGAGAGGCTTCAGG No data
1050964579_1050964582 21 Left 1050964579 9:11782639-11782661 CCTGAGATGGGATAATTTATAAA 0: 7
1: 102
2: 1244
3: 9212
4: 15447
Right 1050964582 9:11782683-11782705 ACTGTACCACATGACTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050964579 Original CRISPR TTTATAAATTATCCCATCTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr