ID: 1050964581

View in Genome Browser
Species Human (GRCh38)
Location 9:11782678-11782700
Sequence GACTCACTGTACCACATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050964579_1050964581 16 Left 1050964579 9:11782639-11782661 CCTGAGATGGGATAATTTATAAA 0: 7
1: 102
2: 1244
3: 9212
4: 15447
Right 1050964581 9:11782678-11782700 GACTCACTGTACCACATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050964581 Original CRISPR GACTCACTGTACCACATGAC TGG Intergenic
No off target data available for this crispr