ID: 1050966212

View in Genome Browser
Species Human (GRCh38)
Location 9:11806411-11806433
Sequence CTCCTAATGGCACTTATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050966212_1050966216 -10 Left 1050966212 9:11806411-11806433 CCAGACATAAGTGCCATTAGGAG No data
Right 1050966216 9:11806424-11806446 CCATTAGGAGCCAATGCATGGGG No data
1050966212_1050966218 6 Left 1050966212 9:11806411-11806433 CCAGACATAAGTGCCATTAGGAG No data
Right 1050966218 9:11806440-11806462 CATGGGGAACCATAAACTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050966212 Original CRISPR CTCCTAATGGCACTTATGTC TGG (reversed) Intergenic
No off target data available for this crispr