ID: 1050966602

View in Genome Browser
Species Human (GRCh38)
Location 9:11811659-11811681
Sequence AGTGTTTCTTGGGGGAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050966596_1050966602 -7 Left 1050966596 9:11811643-11811665 CCTAATTTCCTCTCTGAGTGTTT No data
Right 1050966602 9:11811659-11811681 AGTGTTTCTTGGGGGAACACAGG No data
1050966595_1050966602 -6 Left 1050966595 9:11811642-11811664 CCCTAATTTCCTCTCTGAGTGTT No data
Right 1050966602 9:11811659-11811681 AGTGTTTCTTGGGGGAACACAGG No data
1050966594_1050966602 8 Left 1050966594 9:11811628-11811650 CCTTGCTGGTTCAGCCCTAATTT No data
Right 1050966602 9:11811659-11811681 AGTGTTTCTTGGGGGAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050966602 Original CRISPR AGTGTTTCTTGGGGGAACAC AGG Intergenic
No off target data available for this crispr