ID: 1050966999

View in Genome Browser
Species Human (GRCh38)
Location 9:11817523-11817545
Sequence GCAAATTCTCGTCTGCACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050966996_1050966999 3 Left 1050966996 9:11817497-11817519 CCAAAAGCAGATCGAGACATCCC No data
Right 1050966999 9:11817523-11817545 GCAAATTCTCGTCTGCACGAAGG No data
1050966993_1050966999 26 Left 1050966993 9:11817474-11817496 CCTTCTCCATTCCTGGAGCTTTT No data
Right 1050966999 9:11817523-11817545 GCAAATTCTCGTCTGCACGAAGG No data
1050966994_1050966999 20 Left 1050966994 9:11817480-11817502 CCATTCCTGGAGCTTTTCCAAAA No data
Right 1050966999 9:11817523-11817545 GCAAATTCTCGTCTGCACGAAGG No data
1050966995_1050966999 15 Left 1050966995 9:11817485-11817507 CCTGGAGCTTTTCCAAAAGCAGA No data
Right 1050966999 9:11817523-11817545 GCAAATTCTCGTCTGCACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050966999 Original CRISPR GCAAATTCTCGTCTGCACGA AGG Intergenic