ID: 1050978843

View in Genome Browser
Species Human (GRCh38)
Location 9:11980942-11980964
Sequence TTGATGTTCTTAAAGACCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050978842_1050978843 20 Left 1050978842 9:11980899-11980921 CCTTTGGATGTCTAAATTTTACA No data
Right 1050978843 9:11980942-11980964 TTGATGTTCTTAAAGACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050978843 Original CRISPR TTGATGTTCTTAAAGACCAA TGG Intergenic
No off target data available for this crispr