ID: 1050978843 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:11980942-11980964 |
| Sequence | TTGATGTTCTTAAAGACCAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1050978842_1050978843 | 20 | Left | 1050978842 | 9:11980899-11980921 | CCTTTGGATGTCTAAATTTTACA | No data | ||
| Right | 1050978843 | 9:11980942-11980964 | TTGATGTTCTTAAAGACCAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1050978843 | Original CRISPR | TTGATGTTCTTAAAGACCAA TGG | Intergenic | ||
| No off target data available for this crispr | |||||