ID: 1050980227

View in Genome Browser
Species Human (GRCh38)
Location 9:12001838-12001860
Sequence AGAGACAACCTGCAAATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050980225_1050980227 4 Left 1050980225 9:12001811-12001833 CCTGAAAGGAAACAATCAACAGA No data
Right 1050980227 9:12001838-12001860 AGAGACAACCTGCAAATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050980227 Original CRISPR AGAGACAACCTGCAAATTGG TGG Intergenic
No off target data available for this crispr