ID: 1050980933

View in Genome Browser
Species Human (GRCh38)
Location 9:12014693-12014715
Sequence CTTGGAGGCCAAAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050980928_1050980933 0 Left 1050980928 9:12014670-12014692 CCAGCAGATTTCTCAGCAAAAAT No data
Right 1050980933 9:12014693-12014715 CTTGGAGGCCAAAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050980933 Original CRISPR CTTGGAGGCCAAAAGGAAGT GGG Intergenic
No off target data available for this crispr