ID: 1050982994

View in Genome Browser
Species Human (GRCh38)
Location 9:12043647-12043669
Sequence GCAAGTATGGAAGTCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050982994_1050982999 23 Left 1050982994 9:12043647-12043669 CCAGGAGAGACTTCCATACTTGC No data
Right 1050982999 9:12043693-12043715 GGTCTCCTGAGCCTCTGCTGTGG No data
1050982994_1050982997 2 Left 1050982994 9:12043647-12043669 CCAGGAGAGACTTCCATACTTGC No data
Right 1050982997 9:12043672-12043694 GAGTTCCTCTCTAAGTGGACTGG No data
1050982994_1050982996 -3 Left 1050982994 9:12043647-12043669 CCAGGAGAGACTTCCATACTTGC No data
Right 1050982996 9:12043667-12043689 TGCTTGAGTTCCTCTCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050982994 Original CRISPR GCAAGTATGGAAGTCTCTCC TGG (reversed) Intergenic
No off target data available for this crispr