ID: 1050982997

View in Genome Browser
Species Human (GRCh38)
Location 9:12043672-12043694
Sequence GAGTTCCTCTCTAAGTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050982994_1050982997 2 Left 1050982994 9:12043647-12043669 CCAGGAGAGACTTCCATACTTGC No data
Right 1050982997 9:12043672-12043694 GAGTTCCTCTCTAAGTGGACTGG No data
1050982993_1050982997 3 Left 1050982993 9:12043646-12043668 CCCAGGAGAGACTTCCATACTTG No data
Right 1050982997 9:12043672-12043694 GAGTTCCTCTCTAAGTGGACTGG No data
1050982992_1050982997 16 Left 1050982992 9:12043633-12043655 CCACTGATCAGCACCCAGGAGAG No data
Right 1050982997 9:12043672-12043694 GAGTTCCTCTCTAAGTGGACTGG No data
1050982990_1050982997 20 Left 1050982990 9:12043629-12043651 CCTACCACTGATCAGCACCCAGG No data
Right 1050982997 9:12043672-12043694 GAGTTCCTCTCTAAGTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050982997 Original CRISPR GAGTTCCTCTCTAAGTGGAC TGG Intergenic
No off target data available for this crispr