ID: 1050982998

View in Genome Browser
Species Human (GRCh38)
Location 9:12043677-12043699
Sequence GGAGACCAGTCCACTTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050982998_1050982999 -7 Left 1050982998 9:12043677-12043699 CCTCTCTAAGTGGACTGGTCTCC No data
Right 1050982999 9:12043693-12043715 GGTCTCCTGAGCCTCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050982998 Original CRISPR GGAGACCAGTCCACTTAGAG AGG (reversed) Intergenic
No off target data available for this crispr