ID: 1050982999

View in Genome Browser
Species Human (GRCh38)
Location 9:12043693-12043715
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050982995_1050982999 10 Left 1050982995 9:12043660-12043682 CCATACTTGCTTGAGTTCCTCTC No data
Right 1050982999 9:12043693-12043715 GGTCTCCTGAGCCTCTGCTGTGG No data
1050982994_1050982999 23 Left 1050982994 9:12043647-12043669 CCAGGAGAGACTTCCATACTTGC No data
Right 1050982999 9:12043693-12043715 GGTCTCCTGAGCCTCTGCTGTGG No data
1050982998_1050982999 -7 Left 1050982998 9:12043677-12043699 CCTCTCTAAGTGGACTGGTCTCC No data
Right 1050982999 9:12043693-12043715 GGTCTCCTGAGCCTCTGCTGTGG No data
1050982993_1050982999 24 Left 1050982993 9:12043646-12043668 CCCAGGAGAGACTTCCATACTTG No data
Right 1050982999 9:12043693-12043715 GGTCTCCTGAGCCTCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050982999 Original CRISPR GGTCTCCTGAGCCTCTGCTG TGG Intergenic