ID: 1050983574

View in Genome Browser
Species Human (GRCh38)
Location 9:12052803-12052825
Sequence ATTAAGCCCAAAGTTAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050983574_1050983575 15 Left 1050983574 9:12052803-12052825 CCTCAACTAACTTTGGGCTTAAT No data
Right 1050983575 9:12052841-12052863 GTTCATTAATGTGTAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050983574 Original CRISPR ATTAAGCCCAAAGTTAGTTG AGG (reversed) Intergenic