ID: 1050993840

View in Genome Browser
Species Human (GRCh38)
Location 9:12188124-12188146
Sequence ATGAAGAAACTGACACTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050993837_1050993840 11 Left 1050993837 9:12188090-12188112 CCACAAGATAGGTGTGATTACTC No data
Right 1050993840 9:12188124-12188146 ATGAAGAAACTGACACTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050993840 Original CRISPR ATGAAGAAACTGACACTCAG AGG Intergenic