ID: 1051000958

View in Genome Browser
Species Human (GRCh38)
Location 9:12281004-12281026
Sequence TTTGGGGACCCCTACTTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051000944_1051000958 24 Left 1051000944 9:12280957-12280979 CCTGGTTCCTAACAGCCCACAGA 0: 4
1: 247
2: 688
3: 1087
4: 1331
Right 1051000958 9:12281004-12281026 TTTGGGGACCCCTACTTTAGTGG No data
1051000948_1051000958 9 Left 1051000948 9:12280972-12280994 CCCACAGACTGGTACTGGTCCAC No data
Right 1051000958 9:12281004-12281026 TTTGGGGACCCCTACTTTAGTGG No data
1051000956_1051000958 -10 Left 1051000956 9:12280991-12281013 CCACAGCCTGGGGTTTGGGGACC 0: 4
1: 25
2: 82
3: 309
4: 815
Right 1051000958 9:12281004-12281026 TTTGGGGACCCCTACTTTAGTGG No data
1051000949_1051000958 8 Left 1051000949 9:12280973-12280995 CCACAGACTGGTACTGGTCCACA 0: 5
1: 21
2: 80
3: 232
4: 557
Right 1051000958 9:12281004-12281026 TTTGGGGACCCCTACTTTAGTGG No data
1051000946_1051000958 17 Left 1051000946 9:12280964-12280986 CCTAACAGCCCACAGACTGGTAC No data
Right 1051000958 9:12281004-12281026 TTTGGGGACCCCTACTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051000958 Original CRISPR TTTGGGGACCCCTACTTTAG TGG Intergenic
No off target data available for this crispr