ID: 1051005699 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:12340748-12340770 |
| Sequence | ATGGGGAAGTAGAAATAGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1051005699_1051005705 | 0 | Left | 1051005699 | 9:12340748-12340770 | CCAGCCTATTTCTACTTCCCCAT | No data | ||
| Right | 1051005705 | 9:12340771-12340793 | ATTGATGGACCTTATTGTCTTGG | No data | ||||
| 1051005699_1051005707 | 17 | Left | 1051005699 | 9:12340748-12340770 | CCAGCCTATTTCTACTTCCCCAT | No data | ||
| Right | 1051005707 | 9:12340788-12340810 | TCTTGGAATAATATGCAATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1051005699 | Original CRISPR | ATGGGGAAGTAGAAATAGGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||