ID: 1051005699

View in Genome Browser
Species Human (GRCh38)
Location 9:12340748-12340770
Sequence ATGGGGAAGTAGAAATAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051005699_1051005705 0 Left 1051005699 9:12340748-12340770 CCAGCCTATTTCTACTTCCCCAT No data
Right 1051005705 9:12340771-12340793 ATTGATGGACCTTATTGTCTTGG No data
1051005699_1051005707 17 Left 1051005699 9:12340748-12340770 CCAGCCTATTTCTACTTCCCCAT No data
Right 1051005707 9:12340788-12340810 TCTTGGAATAATATGCAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051005699 Original CRISPR ATGGGGAAGTAGAAATAGGC TGG (reversed) Intergenic
No off target data available for this crispr