ID: 1051008936

View in Genome Browser
Species Human (GRCh38)
Location 9:12385962-12385984
Sequence GATACTAGTAAGTTAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051008935_1051008936 -2 Left 1051008935 9:12385941-12385963 CCTGTCTTGTAATTTAAAAGAGA No data
Right 1051008936 9:12385962-12385984 GATACTAGTAAGTTAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051008936 Original CRISPR GATACTAGTAAGTTAAAAAC AGG Intergenic
No off target data available for this crispr