ID: 1051009013

View in Genome Browser
Species Human (GRCh38)
Location 9:12387258-12387280
Sequence CAGTTTGACCAGAGGCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051009013_1051009017 5 Left 1051009013 9:12387258-12387280 CCCACTGGCCTCTGGTCAAACTG No data
Right 1051009017 9:12387286-12387308 TTTGTCACACATAAGATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051009013 Original CRISPR CAGTTTGACCAGAGGCCAGT GGG (reversed) Intergenic
No off target data available for this crispr