ID: 1051012133

View in Genome Browser
Species Human (GRCh38)
Location 9:12430067-12430089
Sequence CACCTAACTCTGGAATCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051012129_1051012133 0 Left 1051012129 9:12430044-12430066 CCAGTATCTTCCAAGCTTCAATC No data
Right 1051012133 9:12430067-12430089 CACCTAACTCTGGAATCCCAAGG No data
1051012130_1051012133 -10 Left 1051012130 9:12430054-12430076 CCAAGCTTCAATCCACCTAACTC No data
Right 1051012133 9:12430067-12430089 CACCTAACTCTGGAATCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051012133 Original CRISPR CACCTAACTCTGGAATCCCA AGG Intergenic
No off target data available for this crispr