ID: 1051014454

View in Genome Browser
Species Human (GRCh38)
Location 9:12458720-12458742
Sequence CTGAATATACAAATAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051014452_1051014454 11 Left 1051014452 9:12458686-12458708 CCTTAGCCAGAAACATCAGTGGT No data
Right 1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG No data
1051014453_1051014454 5 Left 1051014453 9:12458692-12458714 CCAGAAACATCAGTGGTTTTATG No data
Right 1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051014454 Original CRISPR CTGAATATACAAATAGACAA TGG Intergenic
No off target data available for this crispr