ID: 1051019562

View in Genome Browser
Species Human (GRCh38)
Location 9:12525796-12525818
Sequence CTTTCTAAGGGAAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051019553_1051019562 25 Left 1051019553 9:12525748-12525770 CCAGATCTATAACCATTTCACAA No data
Right 1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG No data
1051019554_1051019562 13 Left 1051019554 9:12525760-12525782 CCATTTCACAACAAAACTGAGCT No data
Right 1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051019562 Original CRISPR CTTTCTAAGGGAAAGGGGGA AGG Intergenic
No off target data available for this crispr