ID: 1051022900

View in Genome Browser
Species Human (GRCh38)
Location 9:12567155-12567177
Sequence ACTCATCTCCTGTAGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051022900_1051022905 7 Left 1051022900 9:12567155-12567177 CCCTTCAGCTACAGGAGATGAGT No data
Right 1051022905 9:12567185-12567207 GGGGATACAAAGAAACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051022900 Original CRISPR ACTCATCTCCTGTAGCTGAA GGG (reversed) Intergenic
No off target data available for this crispr