ID: 1051022905

View in Genome Browser
Species Human (GRCh38)
Location 9:12567185-12567207
Sequence GGGGATACAAAGAAACTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051022900_1051022905 7 Left 1051022900 9:12567155-12567177 CCCTTCAGCTACAGGAGATGAGT No data
Right 1051022905 9:12567185-12567207 GGGGATACAAAGAAACTTTCAGG No data
1051022901_1051022905 6 Left 1051022901 9:12567156-12567178 CCTTCAGCTACAGGAGATGAGTC No data
Right 1051022905 9:12567185-12567207 GGGGATACAAAGAAACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051022905 Original CRISPR GGGGATACAAAGAAACTTTC AGG Intergenic
No off target data available for this crispr