ID: 1051027838

View in Genome Browser
Species Human (GRCh38)
Location 9:12635199-12635221
Sequence TTAGTTAGACAGAACTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051027835_1051027838 11 Left 1051027835 9:12635165-12635187 CCAGGAGTTGTTTTTCCTTTTTT No data
Right 1051027838 9:12635199-12635221 TTAGTTAGACAGAACTGATATGG No data
1051027836_1051027838 -4 Left 1051027836 9:12635180-12635202 CCTTTTTTTCCAGACAGCATTAG No data
Right 1051027838 9:12635199-12635221 TTAGTTAGACAGAACTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051027838 Original CRISPR TTAGTTAGACAGAACTGATA TGG Intergenic
No off target data available for this crispr