ID: 1051029463

View in Genome Browser
Species Human (GRCh38)
Location 9:12657642-12657664
Sequence CTGGGGCAAGGGAGTGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051029463_1051029478 21 Left 1051029463 9:12657642-12657664 CCAGATACACTCCCTTGCCCCAG No data
Right 1051029478 9:12657686-12657708 AATGGCTAGATCTCCATGAAGGG No data
1051029463_1051029479 28 Left 1051029463 9:12657642-12657664 CCAGATACACTCCCTTGCCCCAG No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029463_1051029477 20 Left 1051029463 9:12657642-12657664 CCAGATACACTCCCTTGCCCCAG No data
Right 1051029477 9:12657685-12657707 CAATGGCTAGATCTCCATGAAGG No data
1051029463_1051029469 3 Left 1051029463 9:12657642-12657664 CCAGATACACTCCCTTGCCCCAG No data
Right 1051029469 9:12657668-12657690 TTCCTTCCAACCCCACCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051029463 Original CRISPR CTGGGGCAAGGGAGTGTATC TGG (reversed) Intergenic
No off target data available for this crispr