ID: 1051029470

View in Genome Browser
Species Human (GRCh38)
Location 9:12657670-12657692
Sequence AGCCATTGGGTGGGGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051029470_1051029479 0 Left 1051029470 9:12657670-12657692 CCTTCCAACCCCACCCAATGGCT No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029470_1051029482 13 Left 1051029470 9:12657670-12657692 CCTTCCAACCCCACCCAATGGCT No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029470_1051029480 5 Left 1051029470 9:12657670-12657692 CCTTCCAACCCCACCCAATGGCT No data
Right 1051029480 9:12657698-12657720 TCCATGAAGGGAAACTGGATTGG No data
1051029470_1051029477 -8 Left 1051029470 9:12657670-12657692 CCTTCCAACCCCACCCAATGGCT No data
Right 1051029477 9:12657685-12657707 CAATGGCTAGATCTCCATGAAGG No data
1051029470_1051029478 -7 Left 1051029470 9:12657670-12657692 CCTTCCAACCCCACCCAATGGCT No data
Right 1051029478 9:12657686-12657708 AATGGCTAGATCTCCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051029470 Original CRISPR AGCCATTGGGTGGGGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr