ID: 1051029472

View in Genome Browser
Species Human (GRCh38)
Location 9:12657678-12657700
Sequence GGAGATCTAGCCATTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051029472_1051029483 25 Left 1051029472 9:12657678-12657700 CCCCACCCAATGGCTAGATCTCC No data
Right 1051029483 9:12657726-12657748 AGGCAACATTCCCAACACCCAGG No data
1051029472_1051029484 26 Left 1051029472 9:12657678-12657700 CCCCACCCAATGGCTAGATCTCC No data
Right 1051029484 9:12657727-12657749 GGCAACATTCCCAACACCCAGGG No data
1051029472_1051029479 -8 Left 1051029472 9:12657678-12657700 CCCCACCCAATGGCTAGATCTCC No data
Right 1051029479 9:12657693-12657715 AGATCTCCATGAAGGGAAACTGG No data
1051029472_1051029480 -3 Left 1051029472 9:12657678-12657700 CCCCACCCAATGGCTAGATCTCC No data
Right 1051029480 9:12657698-12657720 TCCATGAAGGGAAACTGGATTGG No data
1051029472_1051029482 5 Left 1051029472 9:12657678-12657700 CCCCACCCAATGGCTAGATCTCC No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051029472 Original CRISPR GGAGATCTAGCCATTGGGTG GGG (reversed) Intergenic
No off target data available for this crispr