ID: 1051029475

View in Genome Browser
Species Human (GRCh38)
Location 9:12657683-12657705
Sequence TTCATGGAGATCTAGCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051029475_1051029483 20 Left 1051029475 9:12657683-12657705 CCCAATGGCTAGATCTCCATGAA No data
Right 1051029483 9:12657726-12657748 AGGCAACATTCCCAACACCCAGG No data
1051029475_1051029486 29 Left 1051029475 9:12657683-12657705 CCCAATGGCTAGATCTCCATGAA No data
Right 1051029486 9:12657735-12657757 TCCCAACACCCAGGGTTGATGGG No data
1051029475_1051029482 0 Left 1051029475 9:12657683-12657705 CCCAATGGCTAGATCTCCATGAA No data
Right 1051029482 9:12657706-12657728 GGGAAACTGGATTGGAACAAAGG No data
1051029475_1051029480 -8 Left 1051029475 9:12657683-12657705 CCCAATGGCTAGATCTCCATGAA No data
Right 1051029480 9:12657698-12657720 TCCATGAAGGGAAACTGGATTGG No data
1051029475_1051029485 28 Left 1051029475 9:12657683-12657705 CCCAATGGCTAGATCTCCATGAA No data
Right 1051029485 9:12657734-12657756 TTCCCAACACCCAGGGTTGATGG No data
1051029475_1051029484 21 Left 1051029475 9:12657683-12657705 CCCAATGGCTAGATCTCCATGAA No data
Right 1051029484 9:12657727-12657749 GGCAACATTCCCAACACCCAGGG No data
1051029475_1051029488 30 Left 1051029475 9:12657683-12657705 CCCAATGGCTAGATCTCCATGAA No data
Right 1051029488 9:12657736-12657758 CCCAACACCCAGGGTTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051029475 Original CRISPR TTCATGGAGATCTAGCCATT GGG (reversed) Intergenic
No off target data available for this crispr